Microbiome/Amplicon Service

Summary

Advances in next-generation sequencing technologies have greatly expanded the field of metagenomics (also referred to as community genomics, or environmental genomics), giving researchers better tools to study genetic material from environmental or microbiome samples without cultivating cultures. There are several approaches, applications, and goals within the field of Metagenomics; an important and rapidly growing one is the use of targeted amplicon sequencing to understand the diversity of community samples.

The targeted amplicon approach involves sequencing a phylogenetically informative marker to identify organisms in community samples. The marker used should be present in all of the expected organisms, and, conserved such that the primers can amplify genes from a wide range of individuals but variable enough to offer resolution that is taxonomically useful. A number of different markers are commonly used and of course vary by taxa of interest, but the most commonly used is the 16S rRNA gene for bacterial samples, the 18S for eukaryotes, and ITS for fungal samples.

GGBC uses a targeted amplicon sequencing protocol for Illumina platforms that is simple, cost-effective, and produces good data. In short, the library preparation process involves two PCR steps. The first round of PCR uses target specific primers with overhang sequences to amplify the selected marker and allow for barcoding. In the second round of PCR, Illumina compatible barcodes are added to each amplicon.

GGBC has successfully worked on projects with several different target markers, primers, and types/qualities of samples.

There are several references listed below for further reading and information both on our specific protocol and metagenomics as a whole.

Contact for Genomics and Bioinformatics Consultation

Email Dr. Magdy Alabady at malabady@uga.edu for a consultation on new or existing Genomics and Bioinformatics projects. Also, you can contact Dr. Alabady for assistance with grant proposals and for obtaining a letter of support from GGBC.

Contact for Microbiome Technical Assistance

For technical questions about existing or new Illumina projects, please contact the following Lab Managers;

More contacts

Please visit our “All Inquiries” page for detailed information about who you should contact at GGBC to receive a quick and accurate response.

Crucial recommendations for all samples

  • Use fluorometric based methods for quantification (Qubit or PicoGreen) of the template DNA instead of UV spec based methods (e.g., NanoDrop) to obtain accurate DNA measurement.
  • DNA should have absorbance ratio values of 1.8–2.0.
  • RNA samples can be suspended in RNase-free water or 1X TE buffer prepared with RNase-free water.
  • RNA integrity should be assessed using the Agilent Bioanalyzer (or any similar system).
  • Please add any QC information (Qubit data, Agilent run, fragment analyzer run, gel picture,…) available to the online order form.
  • If you are are submitting 24 or more samples, the samples must be in a 96-well plate and include an Excel file with the sample layout in your order.
  • PLEASE USE V BOTTOM PLATES AND NOT ROUND/FLAT BOTTOM PLATES.

Ideally, submitting 30uL at 25ng/uL of clean DNA extracted with a Qiagen kit or other high-quality protocol gives us the best starting material for targeted amplicon sequencing. However, this is not always possible with environmental or microbiome samples, and attempting to further clean or concentrate rare or arduously acquired samples may be risky. Since our protocol relies on traditional PCR, with some optimization it can be adapted successfully to work with samples of variable qualities and concentrations. If your samples are of low quality or concentration, please consult with us before submitting and submit at least 20uL of each sample. Additionally, please submit extra volume of a few samples for us to use to optimize the protocol. A good test to see if your samples will work with our protocol is to simply test them with a standard PCR using the marker specific primers.

If you want to use primers that we do not currently have/use in our lab we have two options:

  1. Provide us with evidence (gel, Fragment Analyzer etc.) that your samples amplify with that primer pair.
  2. Alternatively, we can order the oligos (without the Illumina overhang) and test them with your samples. If we get amplification, we will then order the primers with the Illumina overhang and proceed with the library preparation.

 

If you decide to do the initial amplification in your lab, we will only charge you for the price of primers with the Illumina overhang. If we are doing the amplification test at GGBC, you will be charged for both primer pairs that we order.

Primer NameLiterature NamesTarget RegionExpected sizeSpecific PrimersReference
Klindworth 16S V1V327F For. Over16S: V1-V3~527AGAGTTTGATCMTGGCTCAGKlindworth et al., 2013
518 Rev. OverGTATTACCGCGGCTGCTGG
Klindworth 16S V4F S-D-Bact-0564-a-S-1516S: V4~253AYTGGGYDTAAAGNGKlindworth et al., 2013
R S-D-Bact-0785-b-A-18TACNVGGGTATCTAATCC
Bradley 18S V418S_EukV4F18S: V4418CCAGCASCYGCGGTAATTCCBradley et al. 2016, Zhao et al. 2019
18S_EukV4RACTTTCGTTCTTGATYRA
Quince 16S V4V516S_Bac515F-Y16S: V4-V5400-500GTGYCAGCMGCCGCGGTAAQuince et al., 2011; Parada et al., 2016
16S_Bac926RCCGYCAATTYMTTTRAGTTT
16S V3V6
16S-338F16S:V3-V6???ACTCCTACGGGAGGCAGCAGT
16S-1052RCGAGCTGACGACAYCCATGCA
Taylor ITS218S_5.8S-FunITS2267-511AACTTTYRRCAAYGGATCWCTLee Taylor et al., 2016
18S_ITS4_FunAGCCTCCGCTTATTGATATGCTTAART
Caporaso 16S V4515f forward 16S: V4300-350GTGYCAGCMGCCGCGGTAACaporaso et al., 2011
806rB ReverseGGACTACNVGGGTWTCTAAT
H9 1862R
H9TTACCTGGTCCGGACATCAA
Reverse Primer-1862RATTGTAGCGCGCGTGCAG
Stoek 18S V9
Euk1391F18S: V9~260GTACACACCGCCCGTCAmaral-Zettler et al. (2009) and Stoek et al. (2010)
EukBrTGATCCTTCTGCAGGTTCACCTAC
Caporaso 16S V4
16s-515FB forward16S: V4300-350GTGYCAGCMGCCGCGGTAAModified from Caporaso et al.  (2011)
16s-806RB ReverseGGACTACNVGGGTWTCTAAT
White ITS1ITS1-F ForwardITS1200-600CTTGGTCATTTAGAGGAAGTAAWhite et al. (1990)
ITS2-R ReverseGCTGCGTTCTTCATCGATGC
Kindworth V3V4
S-D-Bact-0341-b-S-17 (for)16S: V3-V4~464CCTACGGGNGGCWGCAGKindworth et al (2013), Illumina
S-D-Bact-0785-a-A-21 (rev)GACTACHVGGGTATCTAATCC
Beckers V5V7
799F-16s: V5-V7420AACMGGATTAGATACCCKGBeckers et al 2016; Bodenhausen et al., 2013
1193R-ACGTCATCCCCACCTTCC
Vylgalys LSU
LSU-LRoR (forward)LSU 550-700ACCCGCTGAACTTAAGCVilgalys and Hester 1999
LSU-LR5 (reverse)TCCTGAGGGAAACTTCG
Glass Bt2
Bt2a (forward)Beta-tublin~470GGTAACCAAATCGGTGCTGCTTTCGlass and Donaldson 1995
Bt2b (Reverse)ACCCTCAGTGTAGTGACCCTTGGC
Hume ITS2
SYM_VAR_5.8SIIITS-2~400GAATTGCAGAACTCCGTGAACCHume et al. 2013, 2015
SYM_VAR_REV CGGGTTCWCTTGTYTGACTTCATGC
Miya 12S
MiFish-U-F12S~160-180bpGTCGGTAAAACTCGTGCCAGCMiya et al., 2015.
MiFish-U-RCATAGTGGGGTATCTAATCCCAGTTTG
LerayCOI
LerayCOI_FORCo1GGATACATGGATTGAACATGTATTACTCCCTCC
LerayCOI_REVTAATCGACCTTCATCGGGAGTGATCGCCAGAAAGAACTCA
ZBJ COIZBJ-ArtF1c:COI-Arthropods157AGATATTGGAACWTTATATTTTATTTTTGGZeale et al. (2011)
ZBJ-ArtR2c:WACTAATCAATTWCCAAATCCTCC
Braukman COI

MLepF1 (forward)COI407GCTTTCCCACGAATAAATAATABraukman et al., 2019
LepR1 (reverse)TAAACTTCTGGATGTCCAAAAAATCA
HCO2198 (reverse)TAAACTTCAGGGTGACCAAAAAATCA
UniPlant ITS2
UniPlantFITS2187-387TGTGAATTGCARRATYCMGMoorhouse-Gann et al., 2018
UniPlantRCCCGHYTGAYYTGRGGTCDC
Zhao 18S V5V7FW-F81718S: V5-V7379TTAGCATGGAATAATRRAATAGGAZhao et al., 2019
REV-R1196TCTGGACCTGGTGAGTTTCC
PacBio 16S27F27F16SAGRGTTYGATYMTGGCTCAGPacBio 16S protocol
14292RRGYTACCTTGTTACGACTT
Gibson COI
ArF5COIGCICCIGAYATRKCITTYCCICGGibson et al. (2014)
ArR5GTRATIGCICCIGCIARIACIGG
PDSPDSABASGSP-FHybrid poplarATCCTTTCGYTCTTCTCCGC
PDSABASGSP-RTRAAACCATCTTGAGCCTCAACATA
GUXGUX1ABASGSP-FHybrid poplarACAGRTGGATTTGGGGRGGA
GUX1ABASGSP-R GGATAAAAYCCYYTGGCAGA
TBLTBL31ASGSP2,091-FHybrid poplarGGTGGTTGCATGGAGCTTTG
TBL31ASGSP2,502-RACCAGGTAAGGGCAGCTTTC

As we get more information or new primers, the table will be updated.

Contact for Financial Inquiries and Quote Requests

Please email Kim and Elizabeth at ggbc@uga.edu, for financial inquiries or to request a quote. Be as specific as possible, so that they can more quickly assist you.

Table 1. Illumina compatible library preparation fees

llumina Compatible Library Type (submitted in 96 well plate)UGA FeeNon-UGA FeeCommercial Fee
Amplicon specific primers with overhang (if necessary)$150.00$177.00$225.00
PCR reactions and clean up optimization (if necessary)$100.00$118.00$150.00
Amplicons (16S/ITS/Custom)(up to 48 samples per plate)$607$717$911
Amplicons (16S/ITS/Custom)(49 to 96 samples per plate)$903$1066$1355

Table 2. Library pooling and pre-sequencing QC fees

Service DescriptionUGA FeeNon-UGA FeeCommercial Fee
Library Pooling up to 2-24 samples by qPCR$129$153$194
Library Pooling up to 25-48 samples by qPCR$179$212$269
Library Pooling up to 49-96 samples by qPCR$187$221$281
Library Pooling up to 97-144 samples by qPCR$230$272$345
Library Pooling up to 145-192 samples by qPCR$255$301$383
Library Pooling up to 193-288 samples by qPCR$281$332$422
Library Pooling up to 289-384 samples by qPCR$360$425$540
Pre-Sequencing QC (Qubit, FA, Kapa)$120$142$180

Table 3. MiSeq run types

Run TypeMaximum number of reads passing filter
(million)a
Maximum total number of
basesa
UGA FeeNon-UGA FeeCommercial Fee
MiSeq Nano (500 Cycles) (v2) flow cell; PE2502500 Mb$771$910$1,157
MiSeq (500 Cycles) (v2) flow cell; PE25024-307.5-8.5 Gb$1,701$2,008$2,552
MiSeq (600 Cycles) (v3) flow cell; PE30044-50 13.2-15 Gb$2,156$2,545$3,234
References for further information

Peer reviewed articles –

Broad review of metagenomics:

Xu, Jianping. 2006. Microbial ecology in the age of genomics and metagenomics: concepts, tools, and recent advances. Molecular Ecology. 15:1713-1731.

Details and development of the targeted amplicon sequencing method on which our and Illumina’s protocols are based:

Bybee, S.M, et. al. 2011. Targeted Amplicon Sequencing (TAS): A Scalable Next-Gen Approach to Multilocus, Multitaxa Phylogenetics. Genome Biology and Evolution. 3:1312-1323.

Validation of suitability and accuracy of Illumina platforms for community amplicon sequencing:

Caporaso, J.G., et. al.. 2012. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6:1621-1624.

Primer evaluation for 16S studies:

Klindworth, A. 2012. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Research. 41:1

Review of metagenomics focused on public health and clinical microbiology:

Forbes, J.D., et.al. 2017. Metagenomics: the next culture-independent game changer. Frontiers in Microbiology. 8:1069

Other good sources of information –

Illumina’s 16S protocol