Microbiome/Amplicon Service
Overview
Advances in next-generation sequencing (NGS) technologies have transformed the field of metagenomics, enabling researchers to characterize complex microbial and environmental communities without the need for cultivation. Also known as community genomics or environmental genomics, metagenomics provides powerful tools for studying the composition, diversity, and potential function of organisms present in environmental, host-associated, and microbiome samples.
One of the most widely used and cost-effective metagenomic approaches is targeted amplicon sequencing, which focuses on sequencing specific phylogenetically informative marker genes to identify and compare organisms within a community. This approach is particularly valuable for assessing biodiversity, profiling microbial populations, and evaluating how communities change across environments, treatments, or time.
Targeted Amplicon Sequencing
Targeted amplicon sequencing relies on genetic markers that are present across a broad range of organisms while containing sufficient sequence variation to distinguish among taxa. Marker selection depends on the organisms of interest and the goals of the study. Commonly used markers include:
- 16S rRNA for bacterial and archaeal community profiling
- 18S rRNA for eukaryotic community analysis
- Internal Transcribed Spacer (ITS) regions for fungal identification and diversity studies
- Cytochrome c oxidase subunit I (COI) for animal and environmental DNA (eDNA) applications
GGBC Amplicon Sequencing Services
The Georgia Genomics and Bioinformatics Core (GGBC) offers a robust, cost-effective targeted amplicon sequencing workflow optimized for Illumina sequencing platforms. Library preparation utilizes a two-step PCR strategy:
- Target Amplification – Marker-specific primers containing adapter overhangs are used to amplify the region of interest.
- Indexing PCR – Unique Illumina-compatible barcodes are added to each sample, enabling multiplexed sequencing of large sample sets.
GGBC has successfully supported projects involving a wide variety of marker genes, primer sets, sample types, and DNA qualities. Our staff can assist with experimental design, primer selection, sample preparation recommendations, and sequencing strategy development to help ensure project success.
Sample Throughput and Multiplexing
To provide cost-effective sequencing, amplicon sequencing projects are offered in tiered batch sizes:
- Quarter plate: 24 samples minimum
- Half plate
- Full plate
GGBC can multiplex up to 384 uniquely indexed libraries within a single sequencing run, making the platform suitable for studies ranging from pilot projects to large-scale community surveys.
Consultation and Resources
Because marker selection, sequencing depth, primer choice, and bioinformatics analysis can significantly influence project outcomes, GGBC strongly recommends consulting with our staff during the experimental design phase. We can help determine the most appropriate workflow for your research objectives and provide guidance on sample submission requirements.
Additional references and resources describing both the GGBC workflow and metagenomic methodologies are provided below.

Contact for Genomics and Bioinformatics Consultation
Email Dr. Walt Lorenz at wlorenz@uga.edu for a consultation on new or existing Genomics and Bioinformatics projects. Also, you can contact Dr. Lorenz for assistance with grant proposals and for obtaining a letter of support from GGBC.
Contact for Microbiome Technical Assistance
For technical questions about existing or new Illumina projects, please contact one of the following staff members:
- Dr. Patrick Smallwood (patrick.smallwood25@uga.edu)
- Didi Suarez (yzs96757@uga.edu)
| 95oC | 3 min | |
| 95oC | 30 sec | Repeat 25 cycles
* For low concentration samples or problematic amplicons, increase the cycle # up to 30 and/or increase DNA input. |
| 56-65oC | 30 sec | |
| 72oC | 30 sec | |
| 72oC | 4 min |
If you want to use primers that we do not currently have/use in our lab (see Primers Currently Available), there are two options:
First PCR Sample Submission Requirements
If you want to perform the first, gene-specific PCR amplification in your lab, you can send us the amplimers for indexing, pooling, and sequencing. This is a cheaper route than sending us DNA, but you must use primers that have the Illumina universal adapter sequence as described below:
1. Researchers amplify the target regions (16S/18S/ITS/etc.) in their laboratories utilizing their specific primers. The specific primers must have overhangs (universal sequence added to the 5’ end of the specific primers to create binding sites for the barcoded primers in the 2nd PCR step) as follows:
5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-Forward-Specific-Primer-Sequence 3’
5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-Reverse-Specific-Primer-Sequence 3’
2. If you’ve never used our service or are using a new primer pair, researchers must give evidence of an acceptable target region amplification and the lack of secondary PCR products. This can be a good-resolution gel image or BioAnalyzer DNA or Fragment Analyzer NGS traces. The latter two can be done at GGBC for a small fee.
3. Researchers are encouraged to use beads or columns to separate the specific target amplificons from free primers and nucleotides. If they can’t do this step in their laboratories, it can be done at GGBC.
4. Researchers must submit at least 15 µl of the amplicon products in a 96-well V-bottom plates.
The Modified Microbiome Amplicon Sequencing Workflow will include the following steps:
-
Clean the initial PCR product provided by the researcher, if necessary.
-
Check the concentration with the Synergy HT plate reader.
-
Performing the second PCR to add the barcoded Illumina adapters to all samples.
-
Bead clean the second PCR products.
-
Determine the concentration using the Synergy HT plate reader.
-
Assess a randomly selected set of samples to determine the size of the library using the Fragment Analyzer.
-
Pooling the barcoded libraries using equimolar ratio.
-
Determine the size of the pooled library using the Fragment Analyzer.
-
Bead clean the pool with, if necessary.
-
Determine the final pool concentration using Qubit and qPCR.
-
Sequencing.
| Primer Name | Literature Names | Target Region | Expected size | Specific Primers | Reference |
|---|---|---|---|---|---|
| Klindworth 16S V1V3 | 27F For. Over | 16S: V1-V3 | ~527 | AGAGTTTGATCMTGGCTCAG | Klindworth et al., 2013 |
| 518 Rev. Over | GTATTACCGCGGCTGCTGG | ||||
| Klindworth 16S V4 | F S-D-Bact-0564-a-S-15 | 16S: V4 | ~253 | AYTGGGYDTAAAGNG | Klindworth et al., 2013 |
| R S-D-Bact-0785-b-A-18 | TACNVGGGTATCTAATCC | ||||
| Bradley 18S V4 | 18S_EukV4F | 18S: V4 | 418 | CCAGCASCYGCGGTAATTCC | Bradley et al. 2016, Zhao et al. 2019 |
| 18S_EukV4R | ACTTTCGTTCTTGATYRA | ||||
| Quince 16S V4V5 | 16S_Bac515F-Y | 16S: V4-V5 | 400-500 | GTGYCAGCMGCCGCGGTAA | Quince et al., 2011; Parada et al., 2016 |
| 16S_Bac926R | CCGYCAATTYMTTTRAGTTT | ||||
| 16S V3V6 | 16S-338F | 16S:V3-V6??? | ACTCCTACGGGAGGCAGCAGT | ||
| 16S-1052R | CGAGCTGACGACAYCCATGCA | ||||
| Taylor ITS2 | 18S_5.8S-Fun | ITS2 | 267-511 | AACTTTYRRCAAYGGATCWCT | Lee Taylor et al., 2016 |
| 18S_ITS4_Fun | AGCCTCCGCTTATTGATATGCTTAART | ||||
| Caporaso 16S V4 | 515f forward | 16S: V4 | 300-350 | GTGYCAGCMGCCGCGGTAA | Caporaso et al., 2011 |
| 806rB Reverse | GGACTACNVGGGTWTCTAAT | ||||
| H9 1862R | H9 | TTACCTGGTCCGGACATCAA | |||
| Reverse Primer-1862R | ATTGTAGCGCGCGTGCAG | ||||
| Stoek 18S V9 | Euk1391F | 18S: V9 | ~260 | GTACACACCGCCCGTC | Amaral-Zettler et al. (2009) and Stoek et al. (2010) |
| EukBr | TGATCCTTCTGCAGGTTCACCTAC | ||||
| Caporaso 16S V4 | 16s-515FB forward | 16S: V4 | 300-350 | GTGYCAGCMGCCGCGGTAA | Modified from Caporaso et al. (2011) |
| 16s-806RB Reverse | GGACTACNVGGGTWTCTAAT | ||||
| White ITS1 | ITS1-F Forward | ITS1 | 200-600 | CTTGGTCATTTAGAGGAAGTAA | White et al. (1990) |
| ITS2-R Reverse | GCTGCGTTCTTCATCGATGC | ||||
| Kindworth V3V4 | S-D-Bact-0341-b-S-17 (for) | 16S: V3-V4 | ~464 | CCTACGGGNGGCWGCAG | Kindworth et al (2013), Illumina |
| S-D-Bact-0785-a-A-21 (rev) | GACTACHVGGGTATCTAATCC | ||||
| Beckers V5V7 | 799F- | 16s: V5-V7 | 420 | AACMGGATTAGATACCCKG | Beckers et al 2016; Bodenhausen et al., 2013 |
| 1193R- | ACGTCATCCCCACCTTCC | ||||
| Vylgalys LSU | LSU-LRoR (forward) | LSU | 550-700 | ACCCGCTGAACTTAAGC | Vilgalys and Hester 1999 |
| LSU-LR5 (reverse) | TCCTGAGGGAAACTTCG | ||||
| Glass Bt2 | Bt2a (forward) | Beta-tublin | ~470 | GGTAACCAAATCGGTGCTGCTTTC | Glass and Donaldson 1995 |
| Bt2b (Reverse) | ACCCTCAGTGTAGTGACCCTTGGC | ||||
| Hume ITS2 | SYM_VAR_5.8SII | ITS-2 | ~400 | GAATTGCAGAACTCCGTGAACC | Hume et al. 2013, 2015 |
| SYM_VAR_REV | CGGGTTCWCTTGTYTGACTTCATGC | ||||
| Miya 12S | MiFish-U-F | 12S | ~160-180bp | GTCGGTAAAACTCGTGCCAGC | Miya et al., 2015. |
| MiFish-U-R | CATAGTGGGGTATCTAATCCCAGTTTG | ||||
| LerayCO1 | LerayCOI_FOR | Co1 | GGATACATGGATTGAACATGTATTACTCCCTCC | ||
| LerayCOI_REV | TAATCGACCTTCATCGGGAGTGATCGCCAGAAAGAACTCA | ||||
| ZBJ CO1 | ZBJ-ArtF1c: | CO1-Arthropods | 157 | AGATATTGGAACWTTATATTTTATTTTTGG | Zeale et al. (2011) |
| ZBJ-ArtR2c: | WACTAATCAATTWCCAAATCCTCC | ||||
| Braukman CO1 | MLepF1 (forward) | CO1 | 407 | GCTTTCCCACGAATAAATAATA | Braukman et al., 2019 |
| LepR1 (reverse) | TAAACTTCTGGATGTCCAAAAAATCA | ||||
| HCO2198 (reverse) | TAAACTTCAGGGTGACCAAAAAATCA | ||||
| Gibson CO1 | ArF5 | CO1 | GCICCIGAYATRKCITTYCCICG | Gibson et al. (2014) | |
| ArR5 | GTRATIGCICCIGCIARIACIGG | ||||
| UniPlant ITS2 | UniPlantF | ITS2 | 187-387 | TGTGAATTGCARRATYCMG | Moorhouse-Gann et al., 2018 |
| UniPlantR | CCCGHYTGAYYTGRGGTCDC | ||||
| Zhao 18S V5V7 | FW-F817 | 18S: V5-V7 | 379 | TTAGCATGGAATAATRRAATAGGA | Zhao et al., 2019 |
| REV-R1196 | TCTGGACCTGGTGAGTTTCC |
Contact for Financial Inquiries and Quote Requests
Please email Kim at ggbc@uga.edu, for financial inquiries or to request a quote. Be as specific as possible, so that they can more quickly assist you.
Table 1. Illumina compatible library preparation fees
| llumina Compatible Library Type (submitted in 96 well plate) | UGA Fee | Non-UGA Fee | Commercial Fee |
|---|---|---|---|
| Amplicon specific primers with overhang (if necessary) | $150.00 | $177.00 | $188.00 |
| DNA/PCR product clean up (per half plate) | $103.00 | $122.00 | $129.00 |
| DNA/PCR product clean up (per plate) | $201.00 | $238.00 | $252.00 |
| Amplicons (16S/ITS/Custom)(up to 24 samples per plate) | $420.00 | $496.00 | $525.00 |
| Amplicons (16S/ITS/Custom)(up to 48 samples per plate) | $670.00 | $791.00 | $838.00 |
| Amplicons (16S/ITS/Custom)(49 to 96 samples per plate) | $997.00 | $1177.00 | $1247.00 |
| Modified Amplicons (16S/ITS/Custom)(up to 24 samples per plate) | $300.00 | $354.00 | $375.00 |
| Modified Amplicons (16S/ITS/Custom)(up to 48 samples per plate) | $480.00 | $567.00 | $600.00 |
| Modified Amplicons (16S/ITS/Custom)(49 to 96 samples per plate) | $716.00 | $845.00 | $895.00 |
Table 2. Library pooling and pre-sequencing QC fees
| Service Description | UGA Fee | Non-UGA Fee | Commercial Fee |
|---|---|---|---|
| Library Pooling up to 2-24 samples | $60 | $71 | $75 |
| Library Pooling up to 25-48 samples | $105 | $124 | $132 |
| Library Pooling up to 49-96 samples | $162 | $192 | $203 |
| Library Pooling up to 97-144 samples | $234 | $277 | $293 |
| Library Pooling up to 145-192 samples | $306 | $362 | $383 |
| Library Pooling up to 193-288 samples | $436 | $515 | $545 |
| Library Pooling up to 289-384 samples | $565 | $667 | $707 |
| Pre-Sequencing QC (Qubit, FA, Kapa) | $120 | $142 | $150 |
Table 3. Illumina run types
| Run Type | Expected number of reads passing filter (million)a | Expected total number of basesa | UGA Fee | Non-UGA Fee | Commercial Fee |
|---|---|---|---|---|---|
| NextSeq2000 (600 Cycles) flow cell (P1); PE300 | 200 | 60 Gb | $2,493 | $2,942 | $3,117 |
| NextSeq2000 (600 Cycles) flow cell (P2); PE300 | 600 | 180 Gb | $4,709 | $5,557 | $5,887 |
References for further information
Peer reviewed articles –
Broad review of metagenomics:
Xu, Jianping. 2006. Microbial ecology in the age of genomics and metagenomics: concepts, tools, and recent advances. Molecular Ecology. 15:1713-1731.
Details and development of the targeted amplicon sequencing method on which our and Illumina’s protocols are based:
Bybee, S.M, et. al. 2011. Targeted Amplicon Sequencing (TAS): A Scalable Next-Gen Approach to Multilocus, Multitaxa Phylogenetics. Genome Biology and Evolution. 3:1312-1323.
Validation of suitability and accuracy of Illumina platforms for community amplicon sequencing:
Caporaso, J.G., et. al.. 2012. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6:1621-1624.
Primer evaluation for 16S studies:
Klindworth, A. 2012. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Research. 41:1
Review of metagenomics focused on public health and clinical microbiology:
Forbes, J.D., et.al. 2017. Metagenomics: the next culture-independent game changer. Frontiers in Microbiology. 8:1069
Other good sources of information –
