Microbiome/Amplicon Service

Overview

Advances in next-generation sequencing (NGS) technologies have transformed the field of metagenomics, enabling researchers to characterize complex microbial and environmental communities without the need for cultivation. Also known as community genomics or environmental genomics, metagenomics provides powerful tools for studying the composition, diversity, and potential function of organisms present in environmental, host-associated, and microbiome samples.

One of the most widely used and cost-effective metagenomic approaches is targeted amplicon sequencing, which focuses on sequencing specific phylogenetically informative marker genes to identify and compare organisms within a community. This approach is particularly valuable for assessing biodiversity, profiling microbial populations, and evaluating how communities change across environments, treatments, or time.

Targeted Amplicon Sequencing

Targeted amplicon sequencing relies on genetic markers that are present across a broad range of organisms while containing sufficient sequence variation to distinguish among taxa. Marker selection depends on the organisms of interest and the goals of the study. Commonly used markers include:

  • 16S rRNA for bacterial and archaeal community profiling
  • 18S rRNA for eukaryotic community analysis
  • Internal Transcribed Spacer (ITS) regions for fungal identification and diversity studies
  • Cytochrome c oxidase subunit I (COI) for animal and environmental DNA (eDNA) applications

GGBC Amplicon Sequencing Services

The Georgia Genomics and Bioinformatics Core (GGBC) offers a robust, cost-effective targeted amplicon sequencing workflow optimized for Illumina sequencing platforms. Library preparation utilizes a two-step PCR strategy:

  1. Target Amplification – Marker-specific primers containing adapter overhangs are used to amplify the region of interest.
  2. Indexing PCR – Unique Illumina-compatible barcodes are added to each sample, enabling multiplexed sequencing of large sample sets.

GGBC has successfully supported projects involving a wide variety of marker genes, primer sets, sample types, and DNA qualities. Our staff can assist with experimental design, primer selection, sample preparation recommendations, and sequencing strategy development to help ensure project success.

Sample Throughput and Multiplexing

To provide cost-effective sequencing, amplicon sequencing projects are offered in tiered batch sizes:

  • Quarter plate: 24 samples minimum
  • Half plate
  • Full plate

GGBC can multiplex up to 384 uniquely indexed libraries within a single sequencing run, making the platform suitable for studies ranging from pilot projects to large-scale community surveys.

Consultation and Resources

Because marker selection, sequencing depth, primer choice, and bioinformatics analysis can significantly influence project outcomes, GGBC strongly recommends consulting with our staff during the experimental design phase. We can help determine the most appropriate workflow for your research objectives and provide guidance on sample submission requirements.

Additional references and resources describing both the GGBC workflow and metagenomic methodologies are provided below.

A person in a lab coat and gloves uses a pipette at a laboratory workstation with various bottles and containers visible.

Contact for Genomics and Bioinformatics Consultation

Email Dr. Walt Lorenz at wlorenz@uga.edu for a consultation on new or existing Genomics and Bioinformatics projects. Also, you can contact Dr. Lorenz for assistance with grant proposals and for obtaining a letter of support from GGBC.

Contact for Microbiome Technical Assistance

For technical questions about existing or new Illumina projects, please contact one of the following staff members:

Crucial recommendations for all samples

  • Use fluorometric based methods for quantification (Qubit or PicoGreen) of the template DNA instead of UV spec based methods (e.g., NanoDrop) to obtain accurate DNA measurement.
  • DNA should have absorbance ratio values of 1.8–2.0.
  • RNA samples can be suspended in RNase-free water or 1X TE buffer prepared with RNase-free water.
  • RNA integrity should be assessed using the Agilent Bioanalyzer (or any similar system).
  • Please add any QC information (Qubit data, Agilent run, fragment analyzer run, gel picture,…) available to the online order form.
  • If you are are submitting 24 or more samples, the samples must shipped be in a 96-well, V-bottomed plate and include an Excel file with the sample layout in your order.
  • PLEASE DO NOT SUBMIT ROUND/FLAT BOTTOM PLATES.  Otherwise, you will be charged for transfer to a V-well plate.

DNA Sample Submission Requirements

1. Researchers should submit 25-30 uL of clean DNA extracted with a kit suitable for isolation of environmental DNA, e.g. Qiagen, Zymo, NEB or other high-quality protocol.  DNA concentration should be on the order of 15-25 ng/uL.

2. For very low concentration or low quality samples that aren’t suitable for column-based purification methods because of potential sample loss, please consult with us before submitting samples.  In these cases we need at least 20 uL of each sample and  additional volume for several samples for PCR optimization Optimization charges may apply. A better approach to see if your samples will work with our protocol is to simply test them with a standard PCR protocol using your marker specific primers with the following PCR cycle times using a hot start Taq polymerase:

95oC 3 min
95oC 30 sec Repeat 25  cycles

* For low concentration samples or problematic amplicons, increase the cycle # up to 30 and/or increase DNA input.

56-65oC 30 sec
72oC 30 sec
72oC 4 min

If you want to use primers that we do not currently have/use in our lab (see Primers Currently Available), there are two options:

  1. Provide us with supportive evidence (agarose gel image, Fragment Analyzer, etc…) that your samples will amplify with that primer pair.
  2. Alternatively, we can order the oligos (without the Illumina overhang) and test them with your samples. If we get amplification, we will then order the primers with the Illumina overhang and proceed with the library preparation.

If you decide to do the initial amplification in your lab, we will only charge you for the price of primers with the Illumina overhang (see below). If we are doing the amplification test at GGBC, you will be charged for both primer pairs that we order.

 

First PCR Sample Submission Requirements

If you want to perform the first, gene-specific PCR amplification in your lab, you can send us the amplimers for indexing, pooling, and sequencing.  This is a cheaper route than sending us DNA, but you must use primers that have the Illumina universal adapter sequence as described below:

1. Researchers amplify the target regions (16S/18S/ITS/etc.) in their laboratories utilizing their specific primers. The specific primers must have overhangs (universal sequence added to the 5’ end of the specific primers to create binding sites for the barcoded primers in the 2nd PCR step) as follows:

5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-Forward-Specific-Primer-Sequence 3’

5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-Reverse-Specific-Primer-Sequence 3’

2. If you’ve never used our service or are using a new primer pair, researchers must give evidence of an acceptable target region amplification and the lack of secondary PCR products. This can be a good-resolution gel image or BioAnalyzer DNA or Fragment Analyzer NGS traces. The latter two can be done at GGBC for a small fee.

3. Researchers are encouraged to use beads or columns to separate the specific target amplificons from free primers and nucleotides. If they can’t do this step in their laboratories, it can be done at GGBC.

4. Researchers must submit at least 15 µl of the amplicon products in a 96-well V-bottom plates.

The Modified Microbiome Amplicon Sequencing Workflow will include the following steps:

  1. Clean the initial PCR product provided by the researcher, if necessary.

  2. Check the concentration with the Synergy HT plate reader.

  3. Performing the second PCR to add the barcoded Illumina adapters to all samples.

  4. Bead clean the second PCR products.

  5. Determine the concentration using the Synergy HT plate reader.

  6. Assess a randomly selected set of samples to determine the size of the library using the Fragment Analyzer.

  7. Pooling the barcoded libraries using equimolar ratio.

  8. Determine the size of the pooled library using the Fragment Analyzer.

  9. Bead clean the pool with, if necessary.

  10. Determine the final pool concentration using Qubit and qPCR.

  11. Sequencing.

Primer NameLiterature NamesTarget RegionExpected sizeSpecific PrimersReference
Klindworth 16S V1V327F For. Over16S: V1-V3~527AGAGTTTGATCMTGGCTCAGKlindworth et al., 2013
518 Rev. OverGTATTACCGCGGCTGCTGG
Klindworth 16S V4F S-D-Bact-0564-a-S-1516S: V4~253AYTGGGYDTAAAGNGKlindworth et al., 2013
R S-D-Bact-0785-b-A-18TACNVGGGTATCTAATCC
Bradley 18S V418S_EukV4F18S: V4418CCAGCASCYGCGGTAATTCCBradley et al. 2016, Zhao et al. 2019
18S_EukV4RACTTTCGTTCTTGATYRA
Quince 16S V4V516S_Bac515F-Y16S: V4-V5400-500GTGYCAGCMGCCGCGGTAAQuince et al., 2011; Parada et al., 2016
16S_Bac926RCCGYCAATTYMTTTRAGTTT
16S V3V6
16S-338F16S:V3-V6???ACTCCTACGGGAGGCAGCAGT
16S-1052RCGAGCTGACGACAYCCATGCA
Taylor ITS218S_5.8S-FunITS2267-511AACTTTYRRCAAYGGATCWCTLee Taylor et al., 2016
18S_ITS4_FunAGCCTCCGCTTATTGATATGCTTAART
Caporaso 16S V4515f forward 16S: V4300-350GTGYCAGCMGCCGCGGTAACaporaso et al., 2011
806rB ReverseGGACTACNVGGGTWTCTAAT
H9 1862R
H9TTACCTGGTCCGGACATCAA
Reverse Primer-1862RATTGTAGCGCGCGTGCAG
Stoek 18S V9
Euk1391F18S: V9~260GTACACACCGCCCGTCAmaral-Zettler et al. (2009) and Stoek et al. (2010)
EukBrTGATCCTTCTGCAGGTTCACCTAC
Caporaso 16S V4
16s-515FB forward16S: V4300-350GTGYCAGCMGCCGCGGTAAModified from Caporaso et al.  (2011)
16s-806RB ReverseGGACTACNVGGGTWTCTAAT
White ITS1ITS1-F ForwardITS1200-600CTTGGTCATTTAGAGGAAGTAAWhite et al. (1990)
ITS2-R ReverseGCTGCGTTCTTCATCGATGC
Kindworth V3V4
S-D-Bact-0341-b-S-17 (for)16S: V3-V4~464CCTACGGGNGGCWGCAGKindworth et al (2013), Illumina
S-D-Bact-0785-a-A-21 (rev)GACTACHVGGGTATCTAATCC
Beckers V5V7
799F-16s: V5-V7420AACMGGATTAGATACCCKGBeckers et al 2016; Bodenhausen et al., 2013
1193R-ACGTCATCCCCACCTTCC
Vylgalys LSU
LSU-LRoR (forward)LSU 550-700ACCCGCTGAACTTAAGCVilgalys and Hester 1999
LSU-LR5 (reverse)TCCTGAGGGAAACTTCG
Glass Bt2
Bt2a (forward)Beta-tublin~470GGTAACCAAATCGGTGCTGCTTTCGlass and Donaldson 1995
Bt2b (Reverse)ACCCTCAGTGTAGTGACCCTTGGC
Hume ITS2
SYM_VAR_5.8SIIITS-2~400GAATTGCAGAACTCCGTGAACCHume et al. 2013, 2015
SYM_VAR_REV CGGGTTCWCTTGTYTGACTTCATGC
Miya 12S
MiFish-U-F12S~160-180bpGTCGGTAAAACTCGTGCCAGCMiya et al., 2015.
MiFish-U-RCATAGTGGGGTATCTAATCCCAGTTTG
LerayCO1
LerayCOI_FORCo1GGATACATGGATTGAACATGTATTACTCCCTCC
LerayCOI_REVTAATCGACCTTCATCGGGAGTGATCGCCAGAAAGAACTCA
ZBJ CO1ZBJ-ArtF1c:CO1-Arthropods157AGATATTGGAACWTTATATTTTATTTTTGGZeale et al. (2011)
ZBJ-ArtR2c:WACTAATCAATTWCCAAATCCTCC
Braukman CO1

MLepF1 (forward)CO1407GCTTTCCCACGAATAAATAATABraukman et al., 2019
LepR1 (reverse)TAAACTTCTGGATGTCCAAAAAATCA
HCO2198 (reverse)TAAACTTCAGGGTGACCAAAAAATCA
Gibson CO1
ArF5CO1GCICCIGAYATRKCITTYCCICGGibson et al. (2014)
ArR5GTRATIGCICCIGCIARIACIGG
UniPlant ITS2
UniPlantFITS2187-387TGTGAATTGCARRATYCMGMoorhouse-Gann et al., 2018
UniPlantRCCCGHYTGAYYTGRGGTCDC
Zhao 18S V5V7FW-F81718S: V5-V7379TTAGCATGGAATAATRRAATAGGAZhao et al., 2019
REV-R1196TCTGGACCTGGTGAGTTTCC

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Contact for Financial Inquiries and Quote Requests

Please email Kim at ggbc@uga.edu, for financial inquiries or to request a quote. Be as specific as possible, so that they can more quickly assist you.

Table 1. Illumina compatible library preparation fees

llumina Compatible Library Type (submitted in 96 well plate)UGA FeeNon-UGA FeeCommercial Fee
Amplicon specific primers with overhang (if necessary)$150.00$177.00$188.00
DNA/PCR product clean up (per half plate)$103.00$122.00$129.00
DNA/PCR product clean up (per plate)$201.00$238.00$252.00
Amplicons (16S/ITS/Custom)(up to 24 samples per plate)$420.00$496.00$525.00
Amplicons (16S/ITS/Custom)(up to 48 samples per plate)$670.00$791.00$838.00
Amplicons (16S/ITS/Custom)(49 to 96 samples per plate)$997.00$1177.00$1247.00
Modified Amplicons (16S/ITS/Custom)(up to 24 samples per plate)$300.00$354.00$375.00
Modified Amplicons (16S/ITS/Custom)(up to 48 samples per plate)$480.00$567.00$600.00
Modified Amplicons (16S/ITS/Custom)(49 to 96 samples per plate)$716.00$845.00$895.00

Table 2. Library pooling and pre-sequencing QC fees

Service DescriptionUGA FeeNon-UGA FeeCommercial Fee
Library Pooling up to 2-24 samples $60$71$75
Library Pooling up to 25-48 samples $105$124$132
Library Pooling up to 49-96 samples$162$192$203
Library Pooling up to 97-144 samples$234$277$293
Library Pooling up to 145-192 samples $306$362$383
Library Pooling up to 193-288 samples$436$515$545
Library Pooling up to 289-384 samples$565$667$707
Pre-Sequencing QC (Qubit, FA, Kapa)$120$142$150

Table 3. Illumina run types

Run TypeExpected number of reads passing filter
(million)a
Expected total number of
basesa
UGA FeeNon-UGA FeeCommercial Fee
NextSeq2000 (600 Cycles) flow cell (P1); PE30020060 Gb

$2,493$2,942$3,117
NextSeq2000 (600 Cycles) flow cell (P2); PE300600180 Gb

$4,709$5,557$5,887

References for further information

Peer reviewed articles –

Broad review of metagenomics:

Xu, Jianping. 2006. Microbial ecology in the age of genomics and metagenomics: concepts, tools, and recent advances. Molecular Ecology. 15:1713-1731.

Details and development of the targeted amplicon sequencing method on which our and Illumina’s protocols are based:

Bybee, S.M, et. al. 2011. Targeted Amplicon Sequencing (TAS): A Scalable Next-Gen Approach to Multilocus, Multitaxa Phylogenetics. Genome Biology and Evolution. 3:1312-1323.

Validation of suitability and accuracy of Illumina platforms for community amplicon sequencing:

Caporaso, J.G., et. al.. 2012. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6:1621-1624.

Primer evaluation for 16S studies:

Klindworth, A. 2012. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Research. 41:1

Review of metagenomics focused on public health and clinical microbiology:

Forbes, J.D., et.al. 2017. Metagenomics: the next culture-independent game changer. Frontiers in Microbiology. 8:1069

Other good sources of information –

Illumina’s 16S protocol