Microbiome/Amplicon Service

Summary

Advances in next-generation sequencing technologies have greatly expanded the field of metagenomics (also referred to as community genomics, or environmental genomics), giving researchers better tools to study genetic material from environmental or microbiome samples without cultivating cultures. There are several approaches, applications, and goals within the field of Metagenomics; an important and rapidly growing one is the use of targeted amplicon sequencing to understand the diversity of community samples.

The targeted amplicon approach involves sequencing a phylogenetically informative marker to identify organisms in community samples. The marker used should be present in all of the expected organisms, and, conserved such that the primers can amplify genes from a wide range of individuals but variable enough to offer resolution that is taxonomically useful. A number of different markers are commonly used and of course vary by taxa of interest, but the most commonly used is the 16S rRNA gene for bacterial samples, the 18S for eukaryotes, and ITS for fungal samples.

GGBC uses a targeted amplicon sequencing protocol for Illumina platforms that is simple, cost-effective, and produces good data. In short, the library preparation process involves two PCR steps. The first round of PCR uses target specific primers with overhang sequences to amplify the selected marker and allow for barcoding. In the second round of PCR, Illumina compatible barcodes are added to each amplicon.

GGBC has successfully worked on projects with several different target markers, primers, and types/qualities of samples.

There are several references listed below for further reading and information both on our specific protocol and metagenomics as a whole.

 

Consultation and Assistance
Contact for Genomics and Bioinformatics Consultation

Email Dr. Magdy Alabady at malabady@uga.edu for a consultation on new or existing Genomics and Bioinformatics projects. Also, you can contact Dr. Alabady for assistance with grant proposals and for obtaining a letter of support from GGBC.

Contact for Microbiome Technical Assistance

For technical questions about existing or new Illumina projects, please contact the following Genomics Professional;

More contacts

Please visit our “All Inquiries” page for detailed information about who you should contact at GGBC to receive a quick and accurate response.

Sample Preparation

As of April 1st, 2022, GGBC implemented the following changes to the Microbiome Amplicon Sequencing Workflow in order to make the greatest use of our time and resources at GGBC to assist the larger genomic community at UGA and beyond:

1. Researchers must amplify the target regions (16S/18S/ITS/etc.) in their laboratories utilizing their specific primers. The specific primers must have overhangs (universal sequence added to the 5’ end of the specific primers to create binding sites for the barcoded primers in the 2nd PCR step) as follows:

5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-Forward-Specific-Primer-Sequence 3’

5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-Reverse-Specific-Primer-Sequence 3’

We have several sets of primers in the lab and are willing to provide aliquots to people who wish to test things out in their own labs.

2. Researchers must give evidence of an acceptable target region amplification and the lack of secondary PCR products. This can be a good-resolution gel image or bioanalyzer DNA or fragment analyzer NGS traces. The latter two can be done at GGBC for a fee.

3. Researchers are encouraged to use beads or columns to separate the specific target amplificons from free primers and nucleotides. If they can’t do this step in their laboratories, it can be done at GGBC.

4. Researchers must submit at least 15 µl of the amplicon products in a 96-well v-bottom plates.

With these modifications, the New Microbiome Amplicon Sequencing Workflow will include the following steps:

  1. Clean the initial PCR product provided by the researcher, if necessary.

  2. Check the concentration with the Synergy HT plate reader.

  3. Performing the second PCR to add the barcoded Illumina adapters to all samples.

  4. Clean the second PCR products using Ampure Beads.

  5. Determine the concentration using the Synergy HT plate reader.

  6. Assess a randomly selected set of samples to determine the size of the library using the Fragment Analyzer.

  7. Pooling the barcoded libraries using equimolar ratio.

  8. Determine the size of the pooled library using the Fragment Analyzer.

  9. Clean the pool with Ampur beads if necessary.

  10. Determine the pool concentration using Qubit and qPCR.

  11. Sequencing.

Primers Currently Available at GGBC
Primer NameLiterature NamesTarget RegionExpected sizeSpecific PrimersReference
Klindworth 16S V1V327F For. Over16S: V1-V3~527AGAGTTTGATCMTGGCTCAGKlindworth et al., 2013
518 Rev. OverGTATTACCGCGGCTGCTGG
Klindworth 16S V4F S-D-Bact-0564-a-S-1516S: V4~253AYTGGGYDTAAAGNGKlindworth et al., 2013
R S-D-Bact-0785-b-A-18TACNVGGGTATCTAATCC
Bradley 18S V418S_EukV4F18S: V4418CCAGCASCYGCGGTAATTCCBradley et al. 2016, Zhao et al. 2019
18S_EukV4RACTTTCGTTCTTGATYRA
Quince 16S V4V516S_Bac515F-Y16S: V4-V5400-500GTGYCAGCMGCCGCGGTAAQuince et al., 2011; Parada et al., 2016
16S_Bac926RCCGYCAATTYMTTTRAGTTT
16S V3V6
16S-338F16S:V3-V6???ACTCCTACGGGAGGCAGCAGT
16S-1052RCGAGCTGACGACAYCCATGCA
Taylor ITS218S_5.8S-FunITS2267-511AACTTTYRRCAAYGGATCWCTLee Taylor et al., 2016
18S_ITS4_FunAGCCTCCGCTTATTGATATGCTTAART
Caporaso 16S V4515f forward 16S: V4300-350GTGYCAGCMGCCGCGGTAACaporaso et al., 2011
806rB ReverseGGACTACNVGGGTWTCTAAT
H9 1862R
H9TTACCTGGTCCGGACATCAA
Reverse Primer-1862RATTGTAGCGCGCGTGCAG
Stoek 18S V9
Euk1391F18S: V9~260GTACACACCGCCCGTCAmaral-Zettler et al. (2009) and Stoek et al. (2010)
EukBrTGATCCTTCTGCAGGTTCACCTAC
Caporaso 16S V4
16s-515FB forward16S: V4300-350GTGYCAGCMGCCGCGGTAAModified from Caporaso et al.  (2011)
16s-806RB ReverseGGACTACNVGGGTWTCTAAT
White ITS1ITS1-F ForwardITS1200-600CTTGGTCATTTAGAGGAAGTAAWhite et al. (1990)
ITS2-R ReverseGCTGCGTTCTTCATCGATGC
Kindworth V3V4
S-D-Bact-0341-b-S-17 (for)16S: V3-V4~464CCTACGGGNGGCWGCAGKindworth et al (2013), Illumina
S-D-Bact-0785-a-A-21 (rev)GACTACHVGGGTATCTAATCC
Beckers V5V7
799F-16s: V5-V7420AACMGGATTAGATACCCKGBeckers et al 2016; Bodenhausen et al., 2013
1193R-ACGTCATCCCCACCTTCC
Vylgalys LSU
LSU-LRoR (forward)LSU 550-700ACCCGCTGAACTTAAGCVilgalys and Hester 1999
LSU-LR5 (reverse)TCCTGAGGGAAACTTCG
Glass Bt2
Bt2a (forward)Beta-tublin~470GGTAACCAAATCGGTGCTGCTTTCGlass and Donaldson 1995
Bt2b (Reverse)ACCCTCAGTGTAGTGACCCTTGGC
Hume ITS2
SYM_VAR_5.8SIIITS-2~400GAATTGCAGAACTCCGTGAACCHume et al. 2013, 2015
SYM_VAR_REV CGGGTTCWCTTGTYTGACTTCATGC
Miya 12S
MiFish-U-F12S~160-180bpGTCGGTAAAACTCGTGCCAGCMiya et al., 2015.
MiFish-U-RCATAGTGGGGTATCTAATCCCAGTTTG
LerayCOI
LerayCOI_FORCo1GGATACATGGATTGAACATGTATTACTCCCTCC
LerayCOI_REVTAATCGACCTTCATCGGGAGTGATCGCCAGAAAGAACTCA
ZBJ COIZBJ-ArtF1c:COI-Arthropods157AGATATTGGAACWTTATATTTTATTTTTGGZeale et al. (2011)
ZBJ-ArtR2c:WACTAATCAATTWCCAAATCCTCC
Braukman COI

MLepF1 (forward)COI407GCTTTCCCACGAATAAATAATABraukman et al., 2019
LepR1 (reverse)TAAACTTCTGGATGTCCAAAAAATCA
HCO2198 (reverse)TAAACTTCAGGGTGACCAAAAAATCA
UniPlant ITS2
UniPlantFITS2187-387TGTGAATTGCARRATYCMGMoorhouse-Gann et al., 2018
UniPlantRCCCGHYTGAYYTGRGGTCDC
Zhao 18S V5V7FW-F81718S: V5-V7379TTAGCATGGAATAATRRAATAGGAZhao et al., 2019
REV-R1196TCTGGACCTGGTGAGTTTCC
PacBio 16S27F27F16SAGRGTTYGATYMTGGCTCAGPacBio 16S protocol
14292RRGYTACCTTGTTACGACTT
Gibson COI
ArF5COIGCICCIGAYATRKCITTYCCICGGibson et al. (2014)
ArR5GTRATIGCICCIGCIARIACIGG
PDSPDSABASGSP-FHybrid poplarATCCTTTCGYTCTTCTCCGC
PDSABASGSP-RTRAAACCATCTTGAGCCTCAACATA
GUXGUX1ABASGSP-FHybrid poplarACAGRTGGATTTGGGGRGGA
GUX1ABASGSP-R GGATAAAAYCCYYTGGCAGA
TBLTBL31ASGSP2,091-FHybrid poplarGGTGGTTGCATGGAGCTTTG
TBL31ASGSP2,502-RACCAGGTAAGGGCAGCTTTC

As we get more information or new primers, the table will be updated.

Prices and Quotes
Contact for Financial Inquiries and Quote Requests

Please email Kim and Elizabeth at ggbc@uga.edu, for financial inquiries or to request a quote. Be as specific as possible, so that they can more quickly assist you.

Table 1. Illumina compatible library preparation fees

llumina Compatible Library Type (submitted in 96 well plate)UGA FeeNon-UGA FeeCommercial Fee
Amplicon specific primers with overhang (if necessary)$150.00$177.00$188.00
DNA/PCR product clean up (per half plate)$98.00$116.00$123.00
DNA/PCR product clean up (per plate)$191.00$226.00$239.00
Modified Amplicons (16S/ITS/Custom)(up to 48 samples per plate)$318.00$376.00$398.00
Modified Amplicons (16S/ITS/Custom)(49 to 96 samples per plate)$535.00$632.00$669.00

Table 2. Library pooling and pre-sequencing QC fees

Service DescriptionUGA FeeNon-UGA FeeCommercial Fee
Library Pooling up to 2-24 samples by qPCR$129$153$162
Library Pooling up to 25-48 samples by qPCR$179$212$224
Library Pooling up to 49-96 samples by qPCR$187$221$234
Library Pooling up to 97-144 samples by qPCR$230$272$288
Library Pooling up to 145-192 samples by qPCR$255$301$319
Library Pooling up to 193-288 samples by qPCR$281$332$352
Library Pooling up to 289-384 samples by qPCR$360$425$450
Library Pooling up to 2-24 samples by absorbance$32$37.80$40
Library Pooling up to 25-48 samples by absorbance$63$74.50$78.75
Library Pooling up to 49-96 samples by absorbance$101$120$127
Library Pooling up to 97-144 samples by absorbance$150$177$188
Library Pooling up to 145-192 samples by absorbance$199$235$249
Library Pooling up to 193-288 samples by absorbance$285$337$357
Library Pooling up to 289-384 samples by absorbance$371$438$464
Pre-Sequencing QC (Qubit, FA, Kapa)$120$142$150

Table 3. MiSeq run types

Run TypeMaximum number of reads passing filter
(million)a
Maximum total number of
basesa
UGA FeeNon-UGA FeeCommercial Fee
MiSeq Nano (500 Cycles) (v2) flow cell; PE2502500 Mb$831$981$1,039
MiSeq (500 Cycles) (v2) flow cell; PE25024-307.5-8.5 Gb$1,832$2,162$2,290
MiSeq (600 Cycles) (v3) flow cell; PE30044-50 13.2-15 Gb$2,321$2,739$2,902
References
References for further information

Peer reviewed articles –

Broad review of metagenomics:

Xu, Jianping. 2006. Microbial ecology in the age of genomics and metagenomics: concepts, tools, and recent advances. Molecular Ecology. 15:1713-1731.

Details and development of the targeted amplicon sequencing method on which our and Illumina’s protocols are based:

Bybee, S.M, et. al. 2011. Targeted Amplicon Sequencing (TAS): A Scalable Next-Gen Approach to Multilocus, Multitaxa Phylogenetics. Genome Biology and Evolution. 3:1312-1323.

Validation of suitability and accuracy of Illumina platforms for community amplicon sequencing:

Caporaso, J.G., et. al.. 2012. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. The ISME Journal. 6:1621-1624.

Primer evaluation for 16S studies:

Klindworth, A. 2012. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Research. 41:1

Review of metagenomics focused on public health and clinical microbiology:

Forbes, J.D., et.al. 2017. Metagenomics: the next culture-independent game changer. Frontiers in Microbiology. 8:1069

Other good sources of information –

Illumina’s 16S protocol